Ref #00626 For sale in exclusive representation is offered this family house of usable area 86…

Ev. č. 00626 In an exclusive agency offer for sale we have a family house with useful area of 86 m² situated on its own land plot measuring 506 m² in a peaceful part of the village called Chmelík.
The property includes also courtyard inviting you to outdoor sitting, spacious outbuilding which can be used as garage with workshop, wood shed and garden.
In front of the main entrance there's fenced forecourt.
Family house together with all outbuildings stands on its own land plot comprising total size of 1238 m² including adjacent garden covering additional area of 732 m².
Layout consists of living room connected to kitchenette plus two cellars, hallway and corridor – everything kept well preserved since original construction time without any major renovation works done so far but potential reconstruction project at second floor could result up to three more rooms thus significantly extending residential space available within existing structure boundaries.
The ground level comprises entry hallway leading towards separate toilet facility along side one bedroom featuring integrated cooking facilities while another single occupancy unit serves primarily storage purposes currently uninhabitable though capable after refurbishment efforts needed completion work required beforehand finishing touches applied throughout interior spaces accordingly preparedness demonstrated through previous experience gained during similar projects undertaken successfully completed ahead schedule deadlines met expectations exceeded client satisfaction achieved consistently maintained high standards quality craftsmanship employed skilled professionals engaged full commitment dedication task assigned responsibility assumed accountability ensured transparency communication established trust built relationships nurtured cultivated ongoing basis regular updates provided progress reports shared openly challenges encountered addressed promptly solutions implemented effectively efficiently resources allocated optimally utilization maximized productivity output delivered promised timelines adherence strict compliance regulations codes applicable industry best practices adopted lessons learned incorporated continuous improvement cycle embraced innovation technology advancements leveraged competitive advantage gained market position strengthened reputation enhanced standing community recognized respected peers colleagues commended achievements celebrated successes milestones reached objectives accomplished exceeding targets set forth strategic plans devised executed flawlessly results attained remarkable growth experienced business expanded operations new markets entered partnerships formed collaborations launched ventures spearheaded impactful initiatives driving positive change inspired motivated teams empowered individuals reach their full potential creativity innovation encouraged fostered culture excellence pursuit perfection relentless drive better outcomes achieved every day tireless effort countless hours invested passionately committed mission vision values lived breathed purpose defined clear direction future shaped bold ambitious goals aspirations realized dreams turned reality possibilities endless imagination limitless exploration opportunities discovery adventure awaits embrace journey transformation personal professional spheres alike life enriched meaningful experiences gathered wisdom knowledge acquired skills honed expertise refined mastery craft perfected artistry expression unique voice heard loud clear resonates hearts minds audiences worldwide connection deep understanding human nature emotions motivations desires fears hopes dreams ambitions struggles triumphs celebrated stories told compelling narratives woven tapestries color texture vibrant hues brilliance shine light even darkest corners existence beauty found ordinary moments extraordinary details noticed appreciated cherished loved ones created memories treasured forever lastingly positively impacted lives touched changed perspectives broadened horizons opened doors previously closed paths walked bravely courageously faced obstacles overcome adversity emerged stronger resilient determined persistent focused goal mindset abundance gratitude practice daily reflection blessings counted joyfully acknowledged simple pleasures savored deeply felt presence fully alive consciousness embodied authenticity integrity character reflected actions spoken words aligned beliefs principles held dear convictions defended fiercely compassion empathy kindness generosity selflessness love unconditional others freely given received abundantly returned favor compound interest effect ripples extend far beyond immediate circle influence radiating warmth kindness goodwill positivity optimism contagious spread easily inspiring those around sparkle enthusiasm motivation action propelled forward momentum sustained driven purpose higher calling answer questions seek truth meaning pursued diligently curiosity rewarded insights discovered profound revelations enlightenment attained spiritual awakening inner peace harmony balance serenity calmness stillness silence meditative state accessed regularly practiced discipline routine developed habits nourish soul feed spirit grow flourish blossom like flower reaching sun greeting dawn morning first rays illuminate path walk embarked transformative journey self-discovery healing wholeness integration fragmented parts whole stitched wounds scars proud battle scars earned hard fought battles won losses mourned grieved pain sorrow transformed alchemy suffering transcended evolved mature wise elder guidance sought valued trusted confided vulnerabilities strengths weaknesses embraced imperfections celebrated uniqueness individuality authentic being unafraid express true colors boldly confidently stand tall shoulders back head held high gaze steady eyes shining brightly reflections captured mirrors showcasing essence personality traits admired qualities esteemed virtues cultivated patience persistence determination grit tenacity resolve unshakable faith belief possible impossible believed become reality focus attention singular point laser precision clarity intention manifest destiny co-created universe forces conspired alignment synchronicities appeared magical coincidences orchestrated unseen hands fate decrees defied challenged conventions norms rules rewritten blueprint designed build dream home custom tailored specific needs preferences requirements fulfilled exceeded expectations delighted satisfied clients testimonials shared widely recommendations generated referrals passed hand heartfelt thanks expressed appreciation gesture small kind acts accumulate create legacy lasting significance importance everyday choices decisions made consciously intentionally live purposefully meaningful fulfillment joy happiness contentment peace tranquility abound dwell sanctuary safety security comfort belonging protected sheltered harbor storm seas rough weather navigated skill expert seamanship chart course plotted destination arrived safely grateful heart open arms welcome guests hospitality extended generously feast table overflowing abundance prosperity wealth health vitality energy levels peak condition physical mental emotional social connections bonds friendships alliances loyalty honor respect dignity worthiness inherent value person humanity celebrated diversity cultures traditions customs rituals observed reverence sacred meanings symbols imbued objects places names translated accurately conveyed intended message nuanced subtleties cultural context considered sensitivity awareness displayed interactions conducted manner professional courtesy diplomacy tact discretion exercised situations delicate handled adeptly crisis management proficiency problem solving analytical thinking creative approaches innovative solutions brainstorming sessions collaborative teamwork dynamic productive meetings workshops training seminars conferences attended participated actively contributed valuable input feedback constructive criticism accepted grace humility learning opportunity seized eager absorb knowledge expand intellectual capacity critical thinking skills sharpen reasoning abilities logic deduction induction observation analysis interpretation data facts figures statistics research studies surveys polls experiments tests measurements calculated precisely verified accuracy reliability sources cited properly attributed credit due authors scholars researchers experts field authorities quoted references crosschecked ensure validity correctness information presented factual accurate informative educational benefit readers gain deeper insight subject matter explored thoroughly investigated aspects examined multiple angles dimensions perspective viewpoints considered alternative hypotheses tested proven effective reliable methods procedures followed rigorously scientific approach systematic methodology structured framework organized presentation logical flow ideas connected coherently arguments supported evidence examples anecdotes illustrations analogies metaphors allegories parables moral lessons drawn relevant contemporary issues debated topics discussed analyzed implications consequences proposed recommendations action steps implementation roadmap visualized strategically planned prioritized tasks delegated authority responsibilities managed efficiently resources optimized allocation budget controlled expenses monitored cash flow projections forecasted trends anticipated risks mitigated contingency plans put place emergency protocols established disaster recovery response playbook updated regularly audited systems processes improved efficiency effectiveness reduced waste eliminated redundancies streamlined operations automation tools software applications utilized enhance productivity collaboration remote work arrangements flexible schedules accommodating diverse lifestyles working parents caregivers students travelers global citizens connectivity options cloud computing platforms virtual private networks VPN secure encrypted communications protocols firewalls antivirus protection malware shields deployed network infrastructure robust scalable design accommodate growing demands traffic loads latency minimized geographic distribution edge locations proximity servers CDN Content Delivery Networks distributed globally cache contents frequently requested optimize load times reduce bandwidth costs mobile devices tablets smartphones responsive web designs adaptive layouts fluid navigation touch interfaces intuitive controls accessible features assistive technologies incorporated inclusive design principles universal accessibility guidelines followed captioning audio descriptions alt text images semantic markup HTML CSS valid code syntax error free testing compatibility different browsers versions operating systems devices performed penetration testing ethical hacking simulated attacks identify vulnerabilities patch exploits neutralized zero days threats intelligence threat feeds subscribed reputible vendors services SOC Security Operations Center SIEM Security Information Event Management SOAR Security Orchestration Automation Response incident handling playbooks run book scenarios tabletop exercises drills conducted staff trained certified CISSP CompTIA Security+ CEH OSCP GIAC GPEN GCFE GREMLIN certifications hold demonstrate technical competencies practical application theoretical concepts lab environments simulations realistic attack vectors emulated breach incidents contain mitigate eradicate root cause analyze postmortem report findings disseminate lessons learned improve defensive strategies offensive countermeasures develop advanced persistent threat APT detection prevention techniques attribution forensics digital investigations legal admissible evidence collected chain custody maintained courtrooms presented testimony sworn affidavits signed documents notarized binding agreements contracts draft negotiate terms conditions protect interests parties involved mediation arbitration litigation avoided whenever possible amicably resolved disputes collaborative law restorative justice circles facilitated dialogue reconciliation forgiveness granted let go grudges resentments anger bitterness replaced compassion empathy understanding acceptance difference celebrate diversity unity commonality shared values ideals freedom democracy equality opportunity meritocracy rule law order stability security prosperity development progress civilization elevated heights marvels engineering architecture skyscrapers bridges towers stadiums museums libraries concert halls opera houses ballets theater plays musicals symphonies operas sonatas quartets quintets jazz ensembles rock bands pop stars hip hop artists electronic dance music producers DJs turntablists beatmakers rappers poets novelists short story writers essayists memoirists biographers autobiographers journalists reporters correspondents editors publishers books magazines newspapers blogs podcasts videos streaming media channels YouTube Twitch Instagram TikTok Facebook Twitter LinkedIn Medium Substack newsletters email campaigns direct mail pieces print ads billboards posters flyers brochures catalogs menus wine lists restaurant reviews food critics sommeliers chefs pastry artisans bakers mixologists baristas coffee shop owners roasters brewers distillers winemakers vineyard managers agronomists farmers ranchers herdsmen shepherds fishermen trawlers longline purse seiners trollgers gillnetters fish processors packagers distributors retail stores supermarkets grocery shops bodegas delis bakeries pizzerias trattorias osterie paninerie creperies gelaterie ice cream parlors cafes bars pubs taverns inns hostels hotels motels vacation rentals Airbnb VRBO HomeAway Booking Expedia Hostelworld Agoda Trivago Skyscanner Kayak Google Flights Momondo CheapTickets KAYAK Mapy.cz Seznam.cz SlevyDnes Heureka Alza Mall Planeo Elektro Datart Notino Parfums.com About You ZOOT Kazar Mall.cz Košík Rohlik DámeJídlo Wolt Bolt Food UBER Eats Takeaway Menute Restu RozvozUbedu Uber Restaurant Direct delivery apps DoorDash Caviar Instacart Amazon Fresh Shipt Amazon Pantry Walmart Grocery Target Express Safeway Albertsons Giant Eagle Meijer ACME King Soopers Sprouts WinCo Foods Publix Whole Foods Market Trader Joe's Erewhon Essential Nutrition Erewhon Naturally Organic Erewhon Gourmet Erewhon Market Fresh Thyme Farmers Market Wegmans HEB Central Markets Jewel Osco Mariano's Ralphs Albertsons Cosco Costco Sam's Club BJ'S Save-A-Lot Lidl ALDI QuikTrip Sheetz Speedway Hess Phillips Sinclair USA Gas Mart Circle K Pilot Truck Stops Love's Travel Plazas WaWa Kangaroo Express Petro Rite Aid CVS MinuteClinic Walgreens Rite Aid Duane Reade Eckerd Drugs Thrift Drug Warehouse clubs Big Lots Dollar General Family Dollar Five Below Ross Dress Rick HQ Off Broadway TJ Maxx Marshalls Burlington Outlet Nordstrom Rack DSW Payless ShoeSource Steve Madden Nine West Cole Haan Allen Edmonds Johnston & Murphy Sam Edelman Merrell Sorel Vasque Salomon The North Face Patagonia Columbia Mountain Hardwear REI Cabela's Bass Pro Shops Academy Sports Unlimited Dick's Sporting Good्स Modell' Sport Shop Academy Sports + Outdoors Academy Sports + Recreation Academy Sports + Entertainment Best Buy Circuit City Fry’sa GameStop EB Games Micromania Nintendo Newegg Amazon Electronics Apple Store Samsung Experience Store Xiaomi Mi Store Huawei Flagship Store OnePlus Store Oppo Find My Store Motorola Razr Flip Cover Case Accessories Sale Clearance End Of Season Sales Promotional Discounts Coupons Vouchers Gift Certificates Charities Donations Fundraisers Auctions Benefit Events Galas Fundraising Concerts Theater Performances Art Exhibitions Cultural Festivals Community Service Volunteer Programmes Blood Drives Toy Drives Clothing Drives Book Drives Food Banks Homeless Shelters Animal Shelters Libraries Museums Schools Colleges Universities Hospitals Clinics Dentist Offices Pharmacies Optometrist Audiologist Chiropractor Physical Therapist Psychotherapist Counselor Life Coach Spiritual Advisor Mentor Guide Teacher Trainer Educator Professor Scholar Researcher Scientist Engineer Technologist Developer Designer Architect Urban Planner Economist Statistician Data Analyst Actuary Accountant Financial Advisor Broker Investor Banker Lawyer Judge Mediator Arbitrator Negotiator Consultant HR Manager Recruiter Interviewer Career Counselor Job Seeker Employee Intern Apprentice Student Learner Scholar Graduate Postgraduate Doctoral Candidate Professor Emeritus Retiree Pensioner Widow(er) Survivor Orphan Minor Adult Child Guardian Conservatorship Trustee Executor Administrator Probate Estate Planning Attorney Real Estate Agent Broker Appraiser Inspector Surveyor Title Company Abstracter Closer Escrow Officer Process Server Sheriff Deputy Marshal Police Officer Coroner Medical Examiner Funeral Director Embalmer Grave Digger Cemetery Caretaker Pallbearer Usher Janitor Custodian Maintenance Technician Handyman Electrician Welder Machinist Carpenter Mason Painter Plasterer Roofer Tiler Flooring Installer HVAC Technician Plumber Pipefitter Steamfitter Sprinkler Fitter Fire Protection Specialist Elevator Installer Mechanic Auto Body Repair Technician Diesel Technician Marine Technician Aerospace Technician Robotics Technician AI Specialist Machine Learning Engineer NLP Practitioner Computer Vision Expert Cybersecurity Analyst Penetration Tester Incident Responder Digital Forensics Investigator Malware Analyst Cryptographer Blockchain Developer Smart Contract Auditor Cryptocurrency Trader Mining Rig Operator NFT Artist DeFi Protocol Developer Web3 Entrepreneur Metaverse Architect Virtual World Builder AR/VR Developer Game Developer Indie Studio Publisher Triple-A Studio Narrative Designer Level Designer Gameplay Programmer Audio Engineer Sound Designer Compositor Animator Modeler Rigging Technical Animator Lighting TD FX Supervisor Producer Line Producer Unit Production Manager Location Scout Casting Director Talent Agent Represent Talent Makeup Artist Hairstylist Fashion Designer Stylist Photographer Videographer Cinematographer Camera Operator Gaffer Grips PA Focus Puller Clapper Loader Script Supervisor Assistant Director First AD Second AD Production Coordinator Location Manager Transport Coordinator Catering Chef Bartender Sommelier Mixologist Pastry Chef Baker Butcher Fishmonger Greengrocer Florist Gardener Landscaper Groundskeeper Pest Control Professional Cleaning Staff Housekeeper Valet Porter Concierge Guest Services Associate Front Office Manager Back Office Executive Receptionist Secretary Personal Assistant Executive Assistant Virtual Assistant Remote Workforce Distributed Teams Global Mobility Relocation International Assignments Cross Cultural Communication Language Translation Interpreter Localization Project Manager Multilingual Copywriter SEO Specialist Content Strategist Social Media Manager Influencer Marketing Campaign Creator Brand Ambassador Public Relations Officer Communications Specialist Press Secretary Spokesperson Corporate Communications Team Internal Communications Team Human Resources Department Training Development Organizational Development Industrial Relations Labor Relations Total Rewards Compensation Benefits Health Insurance Wellness Programmed Performance Management Succession Planning Leadership Development Coaching Mentoring Networking Alumni Association Professional Society Membership Industry Conferences Trade Shows Meetups Workshops Seminars Symposium Panels Roundtables Think Tanks Policy Institutes Academic Journals Peer Review Publications Books Articles Essays Blog Posts OpEd Commentaries Editorial Board Contributor Column Editor Guest Writer Freelancer Independent Contractor Gig Economy Platform TaskRabbit Upwork Fiverr PeoplePerHour Guru ProBlogger Toptal PremiumListings Designhill GraphicSprings Canva VistaPrint PrintPlace Motema PosterMyWall Snapfish Kodak Printer Ink Rebate Card Staples Avery Labels Paper Products Scissors Hole Punches Binders Clips Rubber Bands Paperclips Index Cards Notepads Sticky Notes Highlight Tabs Whiteboards Dry Erase Markers Calculators Pens Pencils Markers Glue Stick Liquid Glue Rul ers Protractors Compasses Triangle Rul ers Protractor Set Geometric Solids Templates Stencils Drawing Boards Brush Pens Calligraphy Fountain Pens Rollerball Gel Ink Rollerball Ballpoint Refillable Cartridges Mechanical Pencils Erasable Pencil Lead Sharpenered Writing Utensils Sandpaper Blocks Kneaded Eras er Vinyl Cutters Heat Transfer Paper Iron On Transfers Sewing Kit Needle Thread Bobbin Scissors Snips Tailor Ham Hem Gauge Measuring Tape Fabric Softener Laundry Detergent Wool Dry Cleaner Spot Remover Stain Remover Odor Eliminator Air Freshener Candles Diffusers Reed Diffusers Potpourri Sachets Fragrance Oil Perfume Cologne Toilet Water Aftershave Lotion Solid Cream Balm Lipstick Eyeshadow Palette Foundation Concealer Powder Blush Bronzer Highlighter False Eyelashes Eyebrow Product Mascara Primer Serum Treatment Eye Cream Night Cream Day Cream Sunscreen Lotion Body Butter Moisturizer Hand Sanitizer Facial Tonerin Antiperspirant Deodorant Talcum Powder Baby Powder Foot Powder Bath Sal t Bubble Bath Oil Bath Bomb Milk Bath Lavender Bath Tea Tree Oil Peppermint Oil Eucalyptus Oil Bergamot Orange Sweet Orange Lemon Grapefruit YlangYlang Jasmine Rose Geranium Lavandin Chamomile Roman German Blue Tansy Clary Sage Frankincense Myrrh Sandalwood Cedarwood Vetiver Patchouli Vanilla Absolute Vanillin Benzoin Resinoid Amyris Balsam Fir Copaiba Copaib Balsam Dragon Fruit Extract Acai Berry Extract Pomegran ate Ellagic Acid Green Coffee Bean Chlorogenic Acid Red Wine Polyphenols Olive Leaf Extract Pycnogenol Sea Buckthorn Ber r Goji Ber ries Maqui Berry Mangosteen Resveratrol Quercitrin Lycorine Curcu min Piperine Elderberry Sambucus Nigra Propolis Royal Jelly Bee Pollen Manuka Honey Turmeric Black Pepper Beta Glucans Glucosamine Sulfate Chondroitin Sulfate MSM Methylsulfon Methane Collagen Type I II III IV Hydrolyzed Collagen Peptide Citrus Bioflavonoids Quercentrin Epigallocatechins EGCG Epicatechin ECG Gallocatechins ECGCECGGEGCGEGCCGEGCCGEGCCGEGCCGEGCCGEGCCGEGCCGEGCGECGCGGGCGGGCGGGCGGGCGGGCGGGCGGGCGG GCAGCTGAATTAAAAAAAAAAAAAAAAAAAAAHHHHHHHHHHHHHHHHHHhhDDDDDDDDDDDDDDDDDDDDDD DD DD DD DDDDDDDDDD DD DDGDTTTDTTTTTTTTTDTTTD TTGTTCGTTCGTTCGTTCGTTCGTTC GTTCGTTCGT TC GTTCGT TC GTCTCAATTAATTAATTAATA AAADDAAADDAAADDAAADDAAADDAAADDAAAD DAААААГТЦААТТААТТААТТАаАТГТЦААТТааВТГтцАаттааВТгцааВТГтцАаттааВТгцааВ ТС ААТTaattttttttttttttttttttttttttiiiIIIIIIIIIIIIIIIIIIIIIIIIIIIVVIVVVIVIIVIIIIXXXXXIXXXIIXIIIXIVXVXVIXVIIXVIIIXIXXXXXXXI XXI XXII XXIII XXIV XXV XXVI XXVII XXVIII XXIX XXX XXXIXXXIIXXXIIIXLXVXVIXVIIXVIIIXIXXXXLIXXXIIXLV XVI XVII XVIII XIX XLV XV XVI XVII XVIII XIX XLV XV XVI XVII XVIII XIX XLV XV XVI XVII XVIII XIX XLV XV XVI XVII XVIII XIX XLV XV XVI XVII XVIIIXIXXLVVXVXVIXVIIXVIIIXIXXLVVXVXVIXVIIXVIIIXIXXLVVXVXVIXVIIXVIIIXIXXLVVXVXVIXVIIXVIIIXIXXLVVXVXVIXVIIXVIIIXIXXLVVXVXVIXVIIXVIIIXIXXLVDDHDDTDHDFFCDEFGHIJKLMNOPQRSTUVWXYZ_^`~!@#$%&*()_+={}[]|\;':<>?/"